PubMed

bioRxiv [Preprint]. 2024 Oct 24:2024.10.21.619323. doi: 10.1101/2024.10.21.619323.ABSTRACTMass spectrometry imaging (MSI) is a powerful technique for spatially resolved analysis of metabolites and other biomolecules within biological tissues. However, the inherent low spatial resolution of MSI often limits its ability to provide detailed cellular-level information. To address this limitation, we propose a guided super-resolution (GSR) approach that leverages high-resolution Imaging Mass Cytometry (IMC) images to enhance the spatial resolution of low-resolution MSI data. By using these detailed IMC images as guides, we improve the resolution of MSI images, creating high-resolution metabolite maps. This enhancement facilitates more precise analysis of cellular structures and tissue architectures, providing deeper insights into super-resolved spatial metabolomics at the single-cell level.PMID:39484548 | PMC:PMC11526965 | DOI:10.1101/2024.10.21.619323

bioRxiv [Preprint]. 2024 Oct 24:2024.04.24.590907. doi: 10.1101/2024.04.24.590907.ABSTRACTRight heart failure (RHF) is a leading cause of mortality in multiple cardiovascular diseases and preclinical and human data suggest impaired metabolism is a significant contributor to right-sided cardiac dysfunction. Ferroptosis is a nonapopotic form of cell death driven by impaired metabolism. Rodent data suggests ferroptosis inhibition can restore mitochondrial electron transport chain function and enhance cardiac contractility in left heart failure models, but the effects of ferroptosis inhibition in translational large animal models of RHF are unknown. Here, we showed ferrostatin-1 mediated ferroptosis antagonism improve right heart structure and function in pulmonary artery banded pigs. Molecularly, ferrostatin-1 restored mitochondrial cristae structure and combatted downregulation of electron transport chain proteins. Metabolomics and lipidomics analyses revealed ferrostatin-1 improved fatty acid metabolism. Thus, these translational data suggest ferroptosis may be a therapeutic target for RHF.PMID:39484509 | PMC:PMC11526868 | DOI:10.1101/2024.04.24.590907

bioRxiv [Preprint]. 2024 Oct 23:2024.10.22.619727. doi: 10.1101/2024.10.22.619727.ABSTRACTRecurrent urinary tract infections (rUTIs) are a major clinical challenge in postmenopausal women and their increasing prevalence underscores the need to define interactions between the host and the urinary microbiome that may underlie rUTI susceptibility. A body of work has identified the taxonomic profile of the female urinary microbiome associate with aging, menopause, and urinay disease. However, how this microbial community engages with the host niche, including the local biochemical environment of the urogenital tract, in health and disease is yet to be fully defined. This study directly assesses differences in the biochemical environment of the urine, or biochemical ecology, associated with recurrent urinary tract infection (UTI) and defines a microbe-metabolite association network of the female urinary microbiome. By integrating metagenomic and metabolomic data collected from a controlled cohort of women with rUTI, we find that distinct metabolites, such as methionine sulfoxide (Met-SO) and trimethylamine oxide (TMAO), are associated with differences in urinary microbiome diversity. We observe associations between microbial and biochemical beta diversity and unique metabolic networks of uropathogenic Escherichia coli and uroprotective Lactobacillus species, highlighting potential metabolite-driven ecological shifts that may influence UTI susceptibility. We identify a urinary lipid signature of active rUTI that can accurately distinguish (AUC = 0.987) cases controls. Finally, using time-to-relapse data we identify deoxycholic acid (DCA) as a new prognostic indicator for rUTI recurrence. Together these findings suggest that systemic metabolic processes may influence susceptibility, opening new avenues for therapeutic intervention and the development of more accurate diagnostic and prognostic to improve patient outcomes.PMID:39484483 | PMC:PMC11526914 | DOI:10.1101/2024.10.22.619727

bioRxiv [Preprint]. 2024 Oct 21:2024.10.17.618956. doi: 10.1101/2024.10.17.618956.ABSTRACTOur understanding of age-related physiology and metabolism has grown through the study of systems biology, including transcriptomics, single-cell analysis, proteomics and metabolomics. Studies in lab organisms in controlled environments, while powerful and complex, fall short of capturing the breadth of genetic and environmental variation in nature. Thus, there is now a major effort in geroscience to identify aging biomarkers and to develop aging interventions that might be applied across the diversity of humans and other free-living species. To meet this challenge, the Dog Aging Project (DAP) is designed to identify cross-sectional and longitudinal patterns of aging in complex systems, and how these are shaped by the diversity of genetic and environmental variation among companion dogs. Here we surveyed the plasma metabolome from the first year of sampling of the Precision Cohort of the DAP. By incorporating extensive metadata and whole genome sequencing information, we were able to overcome the limitations inherent in breed-based estimates of genetic and physiological effects, and to probe the physiological and dietary basis of the age-related metabolome. We identified a significant effect of age on approximately 40% of measured metabolites. Among other insights, we discovered a potentially novel biomarker of age in the post-translationally modified amino acids (ptmAAs). The ptmAAs, which can only be generated by protein hydrolysis, covaried both with age and with other biomarkers of amino acid metabolism, and in a way that was robust to diet. Clinical measures of kidney function mediated about half of the higher ptmAA levels in older dogs. This work identifies ptmAAs as robust indicators of age in dogs, and points to kidney function as a physiological mediator of age-associated variation in the plasma metabolome.PMID:39484426 | PMC:PMC11526923 | DOI:10.1101/2024.10.17.618956

bioRxiv [Preprint]. 2024 Oct 25:2024.10.25.619450. doi: 10.1101/2024.10.25.619450.ABSTRACTBACKGROUND: Heart failure with preserved ejection fraction (HFpEF) accounts for ∼50% of HF cases, with no effective treatments. The ZSF1-obese rat model recapitulates numerous clinical features of HFpEF including hypertension, obesity, metabolic syndrome, exercise intolerance, and LV diastolic dysfunction. Here, we utilized a systems-biology approach to define the early metabolic and transcriptional signatures to gain mechanistic insight into the pathways contributing to HFpEF development.METHODS: Male ZSF1-obese, ZSF1-lean hypertensive controls, and WKY (wild-type) controls were compared at 14w of age for extensive physiological phenotyping and LV tissue harvesting for unbiased metabolomics, RNA-sequencing, and assessment of mitochondrial morphology and function. Utilizing ZSF1-lean and WKY controls enabled a distinction between hypertension-driven molecular changes contributing to HFpEF pathology, versus hypertension + metabolic syndrome.RESULTS: ZSF1-obese rats displayed numerous clinical features of HFpEF. Comparison of ZSF1-lean vs WKY (i.e., hypertension-exclusive effects) revealed metabolic remodeling suggestive of increased aerobic glycolysis, decreased β-oxidation, and dysregulated purine and pyrimidine metabolism with few transcriptional changes. ZSF1-obese rats displayed worsened metabolic remodeling and robust transcriptional remodeling highlighted by the upregulation of inflammatory genes and downregulation of the mitochondrial structure/function and cellular metabolic processes. Integrated network analysis of metabolomic and RNAseq datasets revealed downregulation of nearly all catabolic pathways contributing to energy production, manifesting in a marked decrease in the energetic state (i.e., reduced ATP/ADP, PCr/ATP). Cardiomyocyte ultrastructure analysis revealed decreased mitochondrial area, size, and cristae density, as well as increased lipid droplet content in HFpEF hearts. Mitochondrial function was also impaired as demonstrated by decreased substrate-mediated respiration and dysregulated calcium handling.CONCLUSIONS: Collectively, the integrated omics approach applied here provides a framework to uncover novel genes, metabolites, and pathways underlying HFpEF, with an emphasis on mitochondrial energy metabolism as a potential target for intervention.PMID:39484400 | PMC:PMC11527111 | DOI:10.1101/2024.10.25.619450

Res Sq [Preprint]. 2024 Oct 18:rs.3.rs-4505077. doi: 10.21203/rs.3.rs-4505077/v1.ABSTRACTTissues store excess nutrients as triglyceride or glycogen, but how these reserves are sensed and communicate remains poorly understood. Here we identify molecular players orchestrating this metabolic balance during fat depletion. We show fat body (FB)-specific depletion of fatty acyl-CoA synthase FASN1 in Drosophila causes near-complete fat loss and metabolic remodeling that dramatically elevates glycogen storage and carbohydrate metabolism. Proteomics and metabolomics identify key factors necessary for rewiring including glycolysis enzymes and target-of-brain-insulin (tobi). FASN1-deficient flies are viable but starvation sensitive, oxidatively stressed, and infertile. We also identify CG10824/cDIP as upregulated in FASN1-depleted Drosophila. cDIP is a leucine-rich-repeat protein with homology to secreted adipokines that fine-tune energy signaling, and is required for fly development in the absence of FASN1. Collectively, we show fat-depleted Drosophila rewire their metabolism to complete development, and identify cDIP as a putative new cytokine that signals fat insufficiency and may regulate energy homeostasis.PMID:39483909 | PMC:PMC11527204 | DOI:10.21203/rs.3.rs-4505077/v1

Front Microbiol. 2024 Oct 16;15:1487393. doi: 10.3389/fmicb.2024.1487393. eCollection 2024.ABSTRACTThe acute exacerbation of chronic obstructive pulmonary disease seriously affects the respiratory system function and quality of life of patients. This study employed 16S rRNA sequencing and metabolomics techniques to analyze the respiratory microbiota and serum metabolites of COPD and AECOPD patients. The results showed that the microbial diversity in the respiratory tract of AECOPD patients was significantly lower than that of COPD patients, and the relative abundance of Bacteroidetes, Prevotella and Neisseria in the respiratory tract of AECOPD patients was significantly lower than that of COPD patients. However, the relative abundance of Haemophilus_D, Veillonella_A and Pseudomonas_E, in AECOPD patients was significantly higher than that of COPD patients, and the ability of respiratory microbiota in AECOPD patients to participate in alanine metabolism was significantly lower than that of COPD patients. Metabolome results further revealed that the serum alanine levels in AECOPD patients were significantly lower than those in COPD patients, and these differential metabolites were mainly involved in linoleic acid metabolism, protein digestion and absorption and regulation of lipolysis in adipocytes. In summary, the structural characteristics of respiratory microbiota in COPD and AECOPD patients are different from those in healthy populations, and their microbiota diversity decreases and microbial community structure and function will also undergo changes when acute exacerbations occur. In addition, the predicted microbial community function and metabolomics results indicate that the onset of AECOPD is mainly related to energy and amino acid metabolism disorders, especially alanine metabolism.PMID:39483760 | PMC:PMC11526122 | DOI:10.3389/fmicb.2024.1487393

Front Microbiol. 2024 Oct 17;15:1467153. doi: 10.3389/fmicb.2024.1467153. eCollection 2024.ABSTRACTElucidation of the adaptation mechanisms and survival strategies of deep-sea microorganisms to extreme environments could provide a theoretical basis for the industrial development of extreme enzymes. There is currently a lack of understanding of the metabolic adaptation mechanisms of deep-sea microorganisms to high-pressure environments. The objective of this study was to investigate the metabolic regulatory mechanisms enabling a strain of the deep-sea bacterium Shewanella eurypsychrophilus to thrive under high-pressure conditions. To achieve this, we used nuclear magnetic resonance-based metabolomic and RNA sequencing-based transcriptomic analyses of S. eurypsychrophilus strain YLB-09, which was previously isolated by our research group and shown to be capable of tolerating high pressure levels and low temperatures. We found that high-pressure conditions had pronounced impacts on the metabolic pattern of YLB-09, as evidenced by alterations in energy, amino acid, and glycerolipid metabolism, among other processes. YLB-09 adapted to the high-pressure conditions of the deep sea by switching from aerobic intracellular energy metabolism to trimethylamine N-oxide respiration, altering the amino acid profile, and regulating the composition and the fluidity of cell membrane. The findings of our study demonstrate the capacity of microorganisms to alter their metabolism in response to elevated pressure, thereby establishing a foundation for a more profound understanding of the survival mechanisms of life in high-pressure environments.PMID:39483757 | PMC:PMC11527400 | DOI:10.3389/fmicb.2024.1467153

Front Plant Sci. 2024 Oct 17;15:1361183. doi: 10.3389/fpls.2024.1361183. eCollection 2024.ABSTRACTPlant growth and development are characterized by systematic and continuous processes, each involving intricate metabolic coordination mechanisms. Mathematical models are essential tools for investigating plant growth and development, metabolic regulation networks, and growth patterns across different stages. These models offer insights into secondary metabolism patterns in plants and the roles of metabolites. The proliferation of data related to plant genomics, transcriptomics, proteomics, and metabolomics in the last decade has underscored the growing importance of mathematical modeling in this field. This review aims to elucidate the principles and types of metabolic models employed in studying plant secondary metabolism, their strengths, and limitations. Furthermore, the application of mathematical models in various plant systems biology subfields will be discussed. Lastly, the review will outline how mathematical models can be harnessed to address research questions in this context.PMID:39483677 | PMC:PMC11524811 | DOI:10.3389/fpls.2024.1361183

Eur Urol Open Sci. 2024 Oct 15;70:21-27. doi: 10.1016/j.euros.2024.09.006. eCollection 2024 Dec.ABSTRACTNon-muscle-invasive bladder cancer (NMIBC) is a heterogeneous disease categorized as low, intermediate, high, or very high risk, for which recurrence and progression rates and thus management strategies differ. Current molecular subclassification of bladder cancer (BC) is mainly based on data for muscle-invasive disease, with very few data for NMIBC. A more accurate classification system is needed for better stratification of NMIBC using multiomics and immunohistopathological molecular data alongside clinical data collected in a prospective cohort. ProCaB (Prospective Sample Collection for Cancer of Bladder) is a single-center non-interventional, prospective study recruiting all eligible patients diagnosed with BC in a tertiary center in the Flanders region of Belgium. Clinical data have been collected in a prospective registry since August 2013. Biosamples (blood, urine, and BC tissue) are collected from each patient at diagnosis and are stored at -80°C at BioBank UZ Leuven after appropriate processing according to the protocol. Multiomics (genomics, epigenetics, transcriptomics, proteomics, lipidomics, metabolomics) and immunohistopathology analyses will be performed on appropriate samples. The target is to enroll 300 patients over a 5-yr period, and all patients will be followed for 5 yr. The objective is to create a biobank of samples from patients diagnosed with BC for use in multiomics and immunohistopathological analyses. Results from these analyses, together with long-term clinical data, can be used for comprehensive multilayered molecular characterization of disease recurrence and progression in intermediate- and (very) high-risk NMIBC, identification of multibiomarker panels for better stratification, and identification of a patient subgroup that does not respond to bacillus Calmette-Guérin treatment. This trial is registered on ClinicalTrials.gov as NCT04167332.PMID:39483518 | PMC:PMC11525467 | DOI:10.1016/j.euros.2024.09.006

Front Immunol. 2024 Oct 17;15:1427055. doi: 10.3389/fimmu.2024.1427055. eCollection 2024.ABSTRACTINTRODUCTION: Forkhead box P3 (Foxp3) T regulatory cells are critical for maintaining self-tolerance, immune homeostasis, and regulating the immune system.METHODS: We investigated interleukin-4 receptor alpha (IL-4Rα) signalling on T regulatory cells (Tregs) during Listeria monocytogenes (L. monocytogenes) infection using a mouse model on a BALB/c background, specifically with IL-4Rα knockdown in Tregs (Foxp3creIL-4Rα-/lox).RESULTS: We showed an impairment of Treg responses, along with a decreased bacterial burden and diminished tissue pathology in the liver and spleen, which translated into better survival. Mechanistically, we observed an enhancement of the Th1 signature, characterised by increased expression of the T-bet transcription factor and a greater number of effector T cells producing IFN-γ, IL-2 following ex-vivo stimulation with heat-killed L. monocytogenes in Foxp3creIL-4Rα-/lox mice. Furthermore, CD8 T cells from Foxp3creIL-4Rα-/lox mice displayed increased cytotoxicity (Granzyme-B) with higher proliferation capacity (Ki-67), better survival (Bcl-2) with concomitant reduced apoptosis (activated caspase 3). In contrast to L. monocytogenes, Foxp3creIL-4Rα-/lox mice displayed similar bacterial burdens, lung pathology and survival during Mycobacterium tuberculosis (M. tuberculosis) infection, despite increased T cell numbers and IFN-γ, TNF and IL-17 production.CONCLUSION: Our results demonstrated that the diminished IL-4Rα signalling on Foxp3+ T regulatory cells resulted in a loss of their functionality, leading to survival benefits in listeriosis but not in tuberculosis.PMID:39483462 | PMC:PMC11524857 | DOI:10.3389/fimmu.2024.1427055

Food Chem X. 2024 Oct 2;24:101872. doi: 10.1016/j.fochx.2024.101872. eCollection 2024 Dec 30.ABSTRACTFoodomics is an interdisciplinary field that integrates various omics technologies to explore the complex relationship between food and human health in depth. This approach offers valuable insights into the biochemical, molecular, and cellular composition of food by employing advanced omics techniques. Its applications span the food industry and human health, including efforts to combat malnutrition, provide dietary recommendations, and ensure food safety. This paper critically examines the successful applications of foodomics across areas such as food safety, quality, traceability, processing, and bioactivity. It highlights the crucial role of metabolomics, proteomics, and transcriptomics in achieving a comprehensive understanding of food components, their functions, and their interactions with human biology.PMID:39483356 | PMC:PMC11525469 | DOI:10.1016/j.fochx.2024.101872

Plant Cell Environ. 2024 Nov 1. doi: 10.1111/pce.15250. Online ahead of print.ABSTRACTSoybeans are an economically vital food crop, which is employed as a key source of oil and plant protein globally. This study identified an EREBP-type transcription factor, GmESR1 (Enhance of Shot Regeneration). GmESR1 overexpression has been observed to significantly increase seed protein content. Furthermore, the molecular mechanism by which GmESR1 affects protein accumulation through transcriptome and metabolomics was also identified. The transcriptomic and metabolomic analyses identified 95 differentially expressed genes and 83 differentially abundant metabolites during the seed mid-maturity stage. Co-analysis strategies revealed that GmESR1 overexpression inhibited the biosynthesis of lignin, cellulose, hemicellulose, and pectin via the phenylpropane biosynthetic pathway, thereby redistributing biomass within cells. The key genes and metabolites impacted by this biochemical process included Gm4CL-like, GmCCR, Syringin, and Coniferin. Moreover, it was also found that GmESR1 binds to (AATATTATCATTAAGTACGGAC) during seed development and inhibits the transcription of GmCCR. GmESR1 overexpression also enhanced sucrose transporter gene expression during seed development and increased the sucrose transport rate. These results offer new insight into the molecular mechanisms whereby GmESR1 increases protein levels within soybean seeds, guiding future molecular-assisted breeding efforts aimed at establishing high-protein soybean varieties.PMID:39483062 | DOI:10.1111/pce.15250

Avian Pathol. 2024 Nov 1:1-23. doi: 10.1080/03079457.2024.2423716. Online ahead of print.ABSTRACTCopper (Cu) is a necessary micro-element and plays important roles in many biochemical processes. However, excessive Cu intake can lead to multi-organ toxicity, especially in the spleen. To gain further insights into the specific mechanisms of splenic toxicity associated with Cu-induced metabolic disorders, 192 one-day-old chickens were selected and randomly divided into four groups for this study. The broilers were fed with diets containing Cu at final concentrations of 11, 110, 220 and 330 mg/kg for 49 days. The results showed that high Cu dietary caused nuclear shrinkage and mitochondrial vacuolization in spleen, and induced splenic injury through regulating the glutathione metabolism, pentose and gluconate interconversion, tryptophan metabolism and glycerophosphatidylcholine metabolism pathways. Moreover, excess Cu could disorder the mitochondrial dynamics via up-regulating the levels of Drp1, Parkin PINK1, and Dynein, and down-regulating the levels of Mfn1, Mfn2 and OPA1. Cu-treatment increased the levels of LC3A, LC3B, mTOR, Beclin1, ATG5, and decreased the p62 level to promote autophagy of splenocytes. Meanwhile, high dose of Cu promoted the splenocytes apoptosis by ascend the levels of p53, BAK-1, Bax, Cyt C and Caspase-3 and descend the level of Bcl-2. These results demonstrated that high dietary Cu could cause autophagy and apoptosis via inducing metabolic disturbances and disordering mitochondrial dynamics in spleen of broiler chicken.PMID:39483061 | DOI:10.1080/03079457.2024.2423716

Anim Biosci. 2024 Oct 28. doi: 10.5713/ab.24.0299. Online ahead of print.ABSTRACTOBJECTIVE: Animals will experience energy deprivation processes such as moulting, clutching, migration and long-distance transportation under natural survival conditions and in production practices, and the body will trigger a series of adaptive metabolic changes during these processes. Fasting and refeeding after fasting can induce remodeling of nutrients and energy metabolism. This study aims to investigate the mechanisms by which the gut microbiota and liver of poultry respond to energy deprivation under specific conditions.METHODS: Ninety 252-day-old laying hens were randomly divided into 3 groups: (1) fed ad libitum (control group); (2) fasted from day 13 to day 17 (fasting group); (3) fasted from day 1 to day 5, then refed on a specific feeding way (refeeding group). After that, the serum, liver, jejunum tissues, and cecum contents were sampled and sent for metabolome, transcriptome, morphology, and 16S rDNA sequencing analyses, respectively.RESULTS: Results showed that food deprivation not only observably decreased the body weight, liver index, and the villus height and villus/crypt ratio of jejunum, but also significantly changed the gut microbiota compositions, serum metabolic profiles, and the hepatic gene expression patterns of laying hens, whereas these changes were effectively reversed by the following refeeding operation. At the same time, metabolome combined transcriptome analysis revealed that both serum differential metabolites and hepatic differential expressed genes (DEGs) were consistently enriched in the lipid and amino metabolism pathways, and strong correlations were synchronously found between the differential metabolites and both of the differential gut microbial genera and DEGs, suggesting the crosstalks among gut, liver and their resulting serum metabolic products.CONCLUSION: The results suggested that the organism might coordinate to maintain metabolic homeostasis under energy deprivation through a combination of changes in gut microbial composition and hepatic gene expression.PMID:39483011 | DOI:10.5713/ab.24.0299

Anim Biosci. 2024 Oct 28. doi: 10.5713/ab.24.0435. Online ahead of print.ABSTRACTOBJECTIVE: Semen cryopreservation acts a crucial role in enhancing breed improvement and conserving genetic resources. However, it often leads to decreased sperm activity and reduced pregnancy rates. Despite significant advancements in semen freezing techniques for goats, the precise factors and mechanisms causing cryo-injury remain unclear.METHODS: In this study, we examined the motility characteristics of fresh semen versus frozen-thawed semen and investigated changes in the metabolite profiles of seminal plasma using liquid chromatograph-mass spectrometry (LC-MS).RESULTS: A total of 364 differentially expressed metabolites (DEMs) were identified between fresh and frozen-thawed semen samples. Among these, 185 metabolites were significantly up-regulated, while 179 were down-regulated (p<0.05). The majority of these DEMs belonged to lipids and lipid-like molecules, as well as organic acids and derivatives. The Kyoto Encyclopedia of Genes and Genomes (KEGG) indicated that these DEMs were primarily involved in pathways related to amino acid synthesis and metabolism. Additionally, metabolite set enrichment analysis (MSEA) underscored the critical role of amino acid synthesis and metabolic pathways in semen cryopreservation. Specific metabolites such as alanine, proline, phenylalanine, tryptophan, tyrosine, adenosine, citric acid, flavin adenine dinucleotide (FAD), and choline emerged as potential biomarkers for sperm cryo-injury in goats.CONCLUSION: These findings provide valuable insights into enhancing the quality of semen cryopreservation in goats, contributing to improved breeding and genetic resource conservation efforts.PMID:39483009 | DOI:10.5713/ab.24.0435

Anim Biosci. 2024 Oct 28. doi: 10.5713/ab.24.0564. Online ahead of print.ABSTRACTOBJECTIVE: Improving meat quality is important for commercial production and breeding. The molecular mechanism of intramuscular fat (IMF) deposition and meat characteristics remain further study.METHODS: This study aimed to study the mechanism of IMF deposition and meat characteristics including redox potential, nutrients compositions and volatile compounds in longissimus dorsi (LD) by comparing with different pig breeds including Shanghai white (SW), Duroc x (Landrace Yorkshire) (DLY) and Laiwu (LW) pigs.RESULTS: Results showed that the contents of IMF, triglyceride (TG), total cholesterol (TC), and redox potential parameters were lower, while the content of MDA and activity of lactate dehydrogenase (LDH) were higher in LD of SW pigs compared with LW pigs (p<0.05). No differences were observed about these parameters between SW and DLY pigs. Also, the contents of medium-long chain fatty acids and γ-aminobutyric acid (GABA) were higher, while Asp was lower in LD of SW pigs compared with LW pigs (p<0.05). Volatile compounds results showed that 6 ketones, 4 alkenes, 11 alkanes, 2 aldehydes, 1 alcohol were increased and cholesterol was decreased in SW pigs compared with LW pigs. Transcriptome results showed that differential expressed genes involved in lipid synthesis, metabolism and transport in LD between SW and LW pigs, which were further verified by qPCR. Spearman correlation showed that HSL and Nedd4 were positively related to contents of TG and IMF, while negatively related to volatile compounds and fatty acids (p<0.05). Plin3 and Mgll were negatively related to contents of TG, IMF and cholesterol, while positively related to MDA, LDH, and volatile compounds (p<0.05). PPARA was negatively related to contents of TC and IMF, and activity of SOD, while positively related to volatile compounds (p<0.05).CONCLUSION: Our study provided new insights into potential mechanisms of IMF deposition, nutrients composition and volatile compounds of muscular tissues of different pig breeds.PMID:39483008 | DOI:10.5713/ab.24.0564

Arthritis Res Ther. 2024 Nov 1;26(1):188. doi: 10.1186/s13075-024-03423-5.ABSTRACTOBJECTIVES: Patients with rheumatoid arthritis (RA) commonly experience a high prevalence of multiple metabolic diseases (MD), leading to higher morbidity and premature mortality. Here, we aimed to investigate the pathogenesis of MD in RA patients (RA_MD) through an integrated multi-omics approach.METHODS: Fecal and blood samples were collected from a total of 181 subjects in this study for multi-omics analyses, including 16S rRNA and internally transcribed spacer (ITS) gene sequencing, metabolomics, transcriptomics, proteomics and phosphoproteomics. Spearman's correlation and protein-protein interaction networks were used to assess the multi-omics data correlations. The Least Absolute Shrinkage and Selection Operator (LASSO) machine learning algorithm were used to identify disease-specific biomarkers for RA_MD diagnosis.RESULTS: Our results found that RA_MD was associated with differential abundance of gut microbiota such as Turicibacter and Neocosmospora, metabolites including decreased unsaturated fatty acid, genes related to linoleic acid metabolism and arachidonic acid metabolism, as well as downregulation of proteins and phosphoproteins involved in cholesterol metabolism. Furthermore, a multi-omics classifier differentiated RA_MD from RA with high accuracy (AUC: 0.958). Compared to gouty arthritis and systemic lupus erythematosus, dysregulation of lipid metabolism showed disease-specificity in RA_MD.CONCLUSIONS: The integration of multi-omics data demonstrates that lipid metabolic pathways play a crucial role in RA_MD, providing the basis and direction for the prevention and early diagnosis of MD, as well as new insights to complement clinical treatment options.PMID:39482717 | DOI:10.1186/s13075-024-03423-5

Mol Cancer. 2024 Oct 31;23(1):245. doi: 10.1186/s12943-024-02114-8.ABSTRACTBACKGROUND: Prostate cancer ranks as the second most frequently diagnosed cancer in men worldwide. Recent research highlights the crucial roles IL6ST-mediated signaling pathways play in the development and progression of various cancers, particularly through hyperactivated STAT3 signaling. However, the molecular programs mediated by IL6ST/STAT3 in prostate cancer are poorly understood.METHODS: To investigate the role of IL6ST signaling, we constitutively activated IL6ST signaling in the prostate epithelium of a Pten-deficient prostate cancer mouse model in vivo and examined IL6ST expression in large cohorts of prostate cancer patients. We complemented these data with in-depth transcriptomic and multiplex histopathological analyses.RESULTS: Genetic cell-autonomous activation of the IL6ST receptor in prostate epithelial cells triggers active STAT3 signaling and significantly reduces tumor growth in vivo. Mechanistically, genetic activation of IL6ST signaling mediates senescence via the STAT3/ARF/p53 axis and recruitment of cytotoxic T-cells, ultimately impeding tumor progression. In prostate cancer patients, high IL6ST mRNA expression levels correlate with better recurrence-free survival, increased senescence signals and a transition from an immune-cold to an immune-hot tumor.CONCLUSIONS: Our findings demonstrate a context-dependent role of IL6ST/STAT3 in carcinogenesis and a tumor-suppressive function in prostate cancer development by inducing senescence and immune cell attraction. We challenge the prevailing concept of blocking IL6ST/STAT3 signaling as a functional prostate cancer treatment and instead propose cell-autonomous IL6ST activation as a novel therapeutic strategy.PMID:39482716 | DOI:10.1186/s12943-024-02114-8

BMC Complement Med Ther. 2024 Oct 31;24(1):379. doi: 10.1186/s12906-024-04669-x.ABSTRACTBACKGROUND PISUM SATIVUM: (PS) is a universal legume plant utilized for both human and animal consumption, particularly its seeds, known as green peas. The processing of PS in food industries and households produces a significant amount of waste that needs to be valorized.METHODS: In this study, the metabolite profiles of the 70% ethanolic extracts of PS wastes, namely peels (PSP) and a combination of leaves and stems (PSLS), were investigated by liquid chromatography-electrospray ionization-quadrupole time-of-flight tandem mass spectrometry (LC-ESI-QTOF-MS/MS) followed by molecular networking.RESULTS: Different classes of metabolites were identified, being flavonoids and their derivatives, along with phenolic acids, the most abundant categories. Additionally, a comprehensive network pharmacology strategy was applied to elucidate potentially active metabolites, key targets, and the pathways involved in cytotoxic activity against breast cancer. This cytotoxic activity was investigated in MCF-7 and MCF-10a cell lines. Results revealed that PSLS extract exhibited a potent cytotoxic activity with a good selectivity index (IC50 = 17.67 and selectivity index of 3.51), compared to the reference drug doxorubicin (IC50 = 2.69 µg/mL and selectivity index of 5.28). Whereas PSP extract appeared to be less potent and selective (IC50 = 32.92 µg/mL and selectivity index of 1.62). A similar performance was also observed for several polyphenolics isolated from the PSLS extract, including methyl cis p-coumarate, trans p-coumaric acid, and liquiritigenin/ 7-methyl liquiritigenin mixture. Methyl cis p-coumarate showed the most potent cytotoxic activity against MCF-7 cell line and the highest selectivity (IC50 = 1.18 µg/mL (6.91 µM) and selectivity index of 27.42). The network pharmacology study revealed that the isolated compounds could interact with several breast cancer-associated protein targets including carbonic anhydrases 1, 2, 4, 9, and 12, as well as aldo-keto reductase family 1 member B1, adenosine A3 receptor, protein tyrosine phosphatase non-receptor type 1, and estrogen receptor 2.CONCLUSION: The uncovered therapeutic potential of PSLS and its metabolite constituents pave the way for an efficient and mindful PS waste valorization, calling for further in-vitro and in-vivo research.PMID:39482666 | DOI:10.1186/s12906-024-04669-x